National Standard Examination in Biology (NSEB) Solved Paper 2016 Part-3

Download PDF of This Page (Size: 201K)

Q: 16. Which of the following structure is not found in a prokaryotic cell?

(i) Plasma membrane

(ii) Ribosomes

(iii) Endoplasmic reticulum

(vi) Golgi bodies

(A)

(B)

(C)

(D)

Answer: (D)

Q: 17. Which of the following is the key compound in the intermediary metabolism of carbohydrates, lipid and proteins

(A) PEP

(B) PGA

(C) Acetyl CoA

(D) ∝ - ketoglutarate

Answer: (C)

Q: 18. Denudation of habitats by which of the following events leads to the fastest secondary succession

(A) Flood

(B) Fire

(C) Earthquake

(D) Volcanic eruption

Answer: (B)

Q: 19. Absence of oxygen will arrest which of the following

(i) EMP Pathway

(ii) TCA cycle

(iii) Chemiosmosis coupling

(iv) Lactate fermentation

(A)

(B)

(C)

(D)

Answer: (D)

Q: 20. A researcher working with nucleic acids found out that the cytosine content in a mRNA molecule was 30% What will be the content of Adenine

(A) 20%

(B) 30%

(C) 40%

(D) Can’t be deduced

Answer: (D)

Q: 21. A retrovirus with a Reverse trAnswercriptase enzyme infects a eukaryotic cell and from a protein whose RNA reads as 5’AUCGACGAUACGAAAGCCGUACGCUAU3’

(A) 5’ TAGCTGCTATGCTTTCGGCATGCATS 3’

(B) 5’ AUCGACGAUACGAAAGCCGUACGCUAU 3’

(C) 5’ UAGCUGCUAUGGUUUGCCGAUGCGAUA 3’

(D) 5’ ATCGACGATACGAAAGCCGTACGCTAT 3’

Answer: (B)

Q: 22. The graph below explains the correlation between the rate of reaction and concentration of can be seen that enzyme catalyses the reaction to significant extent but after certain increase in substrate concentration, rate of reaction remains constant. This be because

Q 22 Image of Rate of Reaction

Q 22 Image of Rate of Reaction

Q 22 Image of Rate of Reaction

(A) At high substrate concentration, enzyme activity gets suppressed

(B) Enzymes activity is directly proportionate to the concentration of substrate

(C) There are no enough enzyme molecules to bind to bind to substrate for catalyzing the reaction at higher concentration

(D) Higher concentration of substrate can degrade the enzyme

Answer: (C)

Q: 23. A student could make out that a specimen he found in a lake was an arthropod but could not assign it to a class. The organism had two pairs antennae and compound eyes on stalk, It must belong to the class

(A) Crustacea

(B) Arachnida

(C) Insecta

(D) Myriapoda

Answer: (C)

For detailed explanations and answers visit - NSEB Answers with detailed explanations

No more confusion, prepare with fully solved previous years questions and detailed FREE video lessons for all Olympiads: NSO, NCO, IMO, and IEO for all classes.