Biotechnology Question Bank, DNA Strand, Double Helix, Pyrimidines

Doorsteptutor material for Bank-PO is prepared by world's top subject experts: fully solved questions with step-by-step explanation- practice your way to success.

Download PDF of This Page (Size: 99K)

Sample Quiz

1. What are the three parts of nucleotide?

2. Use the base-pairing rule; write the complementary strand for the following DNA strand:

DNA strand: A-C-C-G-T-G-A-T-C

Complementary Strand:

3. Which bases are purines? Pyrimidines?

4. Define the following terms:

1. Transcription

2. Translation

3. Stop codon and start codon

4. Central dogma

5. DNA replication

5. How many amino acids can be encoded by the following base sequences? TACTTTAGAGGACCAGTAATT

6. What do you mean by term “Double helix”?

Sample Question Paper Ii (Multiple Choice Type)

1. In which of the following processes does the DNA unzip?

1. Transcription and translation

2. Transcription and replication

3. Replication and translation

4. All of these.

5. None of these.

2. Which DNA strand can base pair to the following DNA strand?A -T- G -C -T- A

1. T-A-C-G-A-T

2. A-T-G-C-T-A

3. U-A-C-G-A-U

4. A-U-G-C-U-A

3. Which of the following nucleotide chains could be part of molecule of RNA?

1. A-T-G-C-C-A

2. A-A-T-A-A-A

3. G-C-C-T-T-G

4. A-U-G-C-C-A

4. A Protein is assembled amino acid by amino acid during the process of……………

1. Replication

2. Translation

3. Transcription

4. Mutation

5. Ribosomes:

1. Transcribe the DNA code onto messenger RNA

2. Binds the anticodons of the transfer RNA

3. Transports the message from the nucleus to the cytoplasm

4. Acts as a vice to hold the manufacturing apparatus together while the protein is being made.

6. The DNA

1. Contains the same amount of adenine as thymine

2. Contains the same amount of cytosine as guanine

3. One strand dictates the composition of the opposite strand.

4. Carries the message from the nucleus to the cytoplasm for protein synthesis.

5. a, b, c is correct.

6. c, d is correct.

7. a, b, d is correct.

Developed by: